CloneID: m3D8
Heavy Chain modification: His-Tagged
Antigen Long Description: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
Origin Pub PMID: 16551636
Buffer Composition: PBS with 0.02% Proclin 300.
Available Custom Conjugation Options: AP, HRP, Fluorescein, APC, PE, Biotin Type A, Biotin Type B, Streptavidin, FluoroProbes 647H, Atto488, APC/Cy7, PE/Cy7
Specificity Statement: Binds unspecifically to double- and single-stranded DNA oligomers.
Application Notes (Clone): This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.