Anti-ssDNA/dsDNA (m3D8)

Anti-ssDNA/dsDNA [m3D8], Recombinant, Fab fragment kappa, Mouse

CloneID: m3D8

Heavy Chain modification: His-Tagged

Antigen Long Description: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC

Origin Pub PMID: 16551636

Buffer Composition: PBS only.

Specificity Statement: Binds unspecifically to double- and single-stranded DNA oligomers.

Application Notes (Clone): This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.

• Artikelnummer: ABAAb00347-1.6-BT
• Hersteller: Absolute Antibody
• Hersteller Artikelnummer: Ab00347-1.6-BT
• Verpackungseinheit: 1 mg
• Mengeneinheit: STK
• Reaktivität: Various species
• Klonalität: Recombinant
• Methode: ELISA, Super-Resolution Microscopy
• Isotyp: Fab fragment kappa
• Wirt: Mouse