Anti-ssDNA/dsDNA (m3D8)

Anti-ssDNA/dsDNA [m3D8], Recombinant, IgG1 kappa, Mouse
Artikelnummer
ABAAb00347-1.1
Verpackungseinheit
200 μg
Hersteller
Absolute Antibody

Verfügbarkeit: wird geladen...
Preis wird geladen...
CloneID: m3D8

Antigen Long Description: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC

Origin Pub PMID: 16551636

Buffer Composition: PBS with 0.02% Proclin 300.

Available Custom Conjugation Options: AP, HRP, Fluorescein, APC, PE, Biotin Type A, Biotin Type B, Streptavidin, FluoroProbes 647H, Atto488, APC/Cy7, PE/Cy7

Specificity Statement: Binds unspecifically to double- and single-stranded DNA oligomers.

Application Notes (Clone): This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.
Mehr Informationen
Artikelnummer ABAAb00347-1.1
Hersteller Absolute Antibody
Hersteller Artikelnummer Ab00347-1.1
Verpackungseinheit 200 μg
Mengeneinheit STK
Reaktivität Various species
Klonalität Recombinant
Methode ELISA, Super-Resolution Microscopy
Isotyp IgG1 kappa
Wirt Mouse
Produktinformation (PDF) Download
MSDS (PDF) Download