CloneID: m3D8
Heavy Chain modification: Fc Silent™
Antigen Long Description: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC
Origin Pub PMID: 16551636
Buffer Composition: PBS with 0.02% Proclin 300.
Available Custom Conjugation Options: AP, HRP, Fluorescein, APC, PE, Biotin Type A, Biotin Type B, Streptavidin, FluoroProbes 647H, Atto488, APC/Cy7, PE/Cy7
Specificity Statement: Binds unspecifically to double- and single-stranded DNA oligomers.
Application Notes (Clone): This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.
Deutsch
English
