NLRP3 Human shRNA Lentivirus

NLRP3 Human shRNA Lentivirus
Artikelnummer
BPS82122
Verpackungseinheit
500 µl x 2
Hersteller
BPS Bioscience

Verfügbarkeit: wird geladen...
Preis wird geladen...
Products from BPS Bioscience require a minimum order value above 400€

Applications: Generate a NLRP3 knockdown cell pool following puromycinGenerate a NLRP3 knockdown cell line following puromycin selection and limiting dilution.

Background: NOD, LRR and pyrin domain containing 3 (NLRP3), also known as NALP3 and cryopyrin, is a pattern recognition receptor (PRR) of the NRL (NOD-like receptor) subfamily. It is involved in the detection of microbes, endogenous and exogenous stress signals. It is expressed in macrophages and when bound to PYCARD (adaptor ASC protein) forms a caspase-1 activating complex named NRLP3 inflammasome. NLRP3 detects uric acid and extracellular ATP in damaged cells, and once activated it leads to an immune response. Upon activation, NLRP3 inflammasome releases its partners HSP90 and SGT1, and binds to PYCARD and caspase-1. Caspase-1 initiates the processing and release of the pro-inflammatory cytokines IL-1β and IL-18 and gasdermin D-mediated pyroptotic cell death. Mutations in NLRP3 are known to cause autoinflammatory and neuroinflammatory diseases, such as Alzheimer's, Parkinson's, and prion disease. NLRP3 is the most extensively studied inflammasome protein to date due to its array of activators and aberrant activation in several inflammatory diseases. Studies into its function and inhibition can lead to the development of therapeutic avenues for the treatment of auto-inflammatory diseases.

Description: The NLRP3 shRNA Lentiviruses are replication incompetent, HIV-based, VSV-G pseudotyped lentiviral particles that are ready to transduce nearly all types of mammalian cells, including primary and non-dividing cells. These particles contain 3 shRNAs (Short hairpin RNA) targeting human NLRP3 driven by a U6 promoter, and a puromycin selection marker (Figures 1). The sequences of the shRNA used are shown.List of shRNA sequences present in the NLRP3 shRNA Lentivirus.Gene Target NLRP3 GAGACTCAGGAGTCGCAATTTNLRP3 GGCTGTAACATTCGGAGATTGNLRP3 TCATCATTCCCGCTATCTTTC

Formulation: The lentivirus particles were produced from HEK293T cells in medium containing 90% DMEM + 10% FBS. Virus particles can be packaged in custom formulations by special request, for an additional fee.

Storage Stability: Lentiviruses are shipped with dry ice. For long term storage, it is recommended to store the lentiviruses at -80°C.

Supplied As: Two vials (500 µl x 2) of lentivirus at a titer ≥5 x 106 TU/ml. The titer varies with each lot; the exact value is provided with each shipment.

Warnings: Avoid freeze/thaw cycles

Biosafety Level: BSL-2

References: Swanson K et al., 2019 Nature Reviews Immunology 19:477-489.
Mehr Informationen
Artikelnummer BPS82122
Hersteller BPS Bioscience
Hersteller Artikelnummer 82122
Green Labware Nein
Verpackungseinheit 500 µl x 2
Mengeneinheit STK
Produktinformation (PDF) Download
MSDS (PDF)
×