Anti-ssDNA/dsDNA (m3D8)

Anti-ssDNA/dsDNA [m3D8], Recombinant, Fab fragment kappa, Mouse
SKU
ABAAb00347-1.6
Packaging Unit
200 μg
Manufacturer
Absolute Antibody

Availability: loading...
Price is loading...
CloneID: m3D8

Heavy Chain modification: His-Tagged

Antigen Long Description: 3`-biotin oligodeoxynucleotide ss(dN)40 with N=CCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAAC

Origin Pub PMID: 16551636

Buffer Composition: PBS with 0.02% Proclin 300.

Available Custom Conjugation Options: AP, HRP, Fluorescein, APC, PE, Biotin Type A, Biotin Type B, Streptavidin, FluoroProbes 647H, Atto488, APC/Cy7, PE/Cy7

Specificity Statement: Binds unspecifically to double- and single-stranded DNA oligomers.

Application Notes (Clone): This catalytic antibody binds to DNA oligomers both single- and double-stranded, irrespective of the sequence, showing DNA-hydrolytic activity. DNA is the principle storage of genetic information and usually sequestered within the nucleus in Eukaryotes. Extracellular DNA is a key danger signal for the immune system and an antigen to disease-causing auto-antibodies (incl. DNA-hydrolysing antibodies) e.g. in Systemic Lupus Erythematosus. Antibody formats comprising different numbers of variable domains may be useful tools in investigating the significance of these catalytic antibodies in disease.
More Information
SKU ABAAb00347-1.6
Manufacturer Absolute Antibody
Manufacturer SKU Ab00347-1.6
Package Unit 200 μg
Quantity Unit STK
Reactivity Various species
Clonality Recombinant
Application ELISA, Super-Resolution Microscopy
Isotype Fab fragment kappa
Host Mouse
Product information (PDF) Download
MSDS (PDF) Download